PRODUKSI DAN BERAT TELUR PADA AYAM STRAIN NOVOGEN BERDASARKAN VARIASI WARNA BULU DAN KUANTIFIKASI GEN TYR (TYROSINASE)

Egg Production and Weight of Novogen Strain Chicken Based on Variations of Feather Color and Tyrosinase (TYR) Gene Quantification
Afidhatul Masruroh1) , Mudawamah*1), Inggit Kentjonowaty1)
1) Program Studi Peternakan Universitas Islam Malang
*Correspondent
Author: mudawamah@unisma.ac.id

Submitted 22 Desember 2021, Accepted 30 Desember 2021

ABSTRAK

Penelitian ini dilakukan di peternakan ayam petelur strain Novogen milik Bapak Hidayat dan laboratorium Biomolekuler UNISMA. Tujuan penelitian ini adalah untuk menganalisa perbedaan produksi dan berat telur pada berbagai fase produksi dilihat dari variasi warna bulu dan kuantifikasi TYR. Metode penelitian yang digunakan adalah deskriptif analitik melalui studi kasus di peternakan ayam petelur dan analisis laboratoium. Sampel yang digunakan untuk data produksi dan berat telur sebanyak 217 ekor ayam petelur dengan warna bulu yang berbeda (39 ekor ayam warna bulu coklat variasi putih (CVP), 58 ekor ayam warna bulu coklat muda (CM), dan 120 ekor ayam warna bulu coklat tua (CT). Kuantifikasi gen TYR menggunakan 27 sampel bulu ayam petelur (9 ulangan dari masing-masing warna bulu). Variabel yang diamati adalah produksi telur pada tiga tahap berbeda (tahap I: umur 18-28, tahap II: umur 29-36, dan tahap III : umur 37-44 minggu), berat telur pada umur berbeda (U1 : 28, U2 : 36, dan U3 : 44 minggu). Analisis data dengan ragam satu arah dan uji beda nyata terkecil (BNT) dan qPCR dengan primer gen TYR. Hasil penelitian menunjukkan produksi dan berat telur pada berbagai warna bulu berbeda sangat nyata (P<0,01). Rataan tertinggi produksi dan berat telur pada warna bulu CT dan rataan terendah pada warna bulu CM. Di sisi lain berbagai warna bulu mempunyai nilai kuantifikasi gen TYR yang berbeda dengan nilai kuantifikasi warna bulu CT tertinggi yaitu 4,17, warna bulu CVP dan CM berturut-turut sebesar 4,02 dan 1,88. Kesimpulan penelitian ini adalah semakin tinggi nilai rataan TYR maka semakin gelap warna bulu ayam strain Novogen yang diikuti dengan semakin tinggi produksi dan berat telur yang dihasilkan dari berbagai fase produksi.

Kata kunci: Ayam petelur, qPCR, kuantitas telur, warna bulu

PERBANDINGAN KADAR DAN VARIASI FENOTIPE ALBUMIN INDUK BERANAK KEMBAR DAN TUNGGAL PADA DOMBA SAPUDI, DORMAS, DAN SUFFAS

Albumin Comparison of Twin and Single lambing in Sapudi, Dormas and Suffas Ewes
Yudi Hartoyo1), Mudawamah 1*), Sumartono1)
1) Program Pascasarjana Peternakan Universitas Islam Malang, Fakultas Peternakan
Universitas islam Malang, Jl. MT Haryono 193 Malang
*Coresponding Autor: mudawamah@unisma.ac.id

Submitted 22 Desember 2021, Accepted 30 Desember 2021

ABSTRAK

Tujuan dari penelitian ini adalah membandingkan kadar albumin dari plasma darah induk domba Sapudi, Dormas, dan Suffas yang beranak kembar (IBK) dan tunggal (IBT). Metode penelitian adalah studi kasus dengan pengambilan sampel dilaksanakan di UPT Pembibitan Ternak dan Hijauan Makanan Ternak Jember Dinas Peternakan Provinsi Jawa Timur. Sampel yang digunakan domba Sapudi dan Dormas dan Suffas. Analisa Albumin dengan menggunakan Bromcresol Green (Albumin Darah),. Analisa data dengan menggunakan SPSS16 ANOVA Single Faktor dan uji lanjut menggunakan LSD (Least Significance Different). Hasil penelitian menunjukkan nilai rataan konsentrasi albumin domba Sapudi kelahiran kembar dan tunggal mempunyai nilai rataan sama hanya pada simpangan baku yaitu 3,83±0,68 g/dL dan 3,83± 0,53 g/dL. Kadar albumin pada bangsa domba Dormas adalah IBK = 4,43±0,92 g/dL dan IBT= 3,78±0,43 g/dL. Domba Suffas mempunyai kadar albumin 5,05±0,72 g/dL (IBK) dan 4,12± 0,66 g/dL(IBT). Berdasarkan uji t tidak berpasangan kadar albumin darah antara induk domba Sapudi, Dormas dan Suffas kelahiran tunggal dan kembar tidak menunjukkan perbedaan yang nyata (P > 0,05). Tetapi dilihat dari nilai rataan
ada kecenderungan kadar albumin induk kelahiran kembar pada domba Dormas dan Suffas lebih tinggi 17,20% dan 22,20%. Sebaliknya berdasarkan variasi fenotipe albumin induk kelahiran kembar lebih bervariasi 8,82-66,15% dibandingkan dengan induk beranak tunggal baik pada Sapudi, Dormas, maupun Suffas. Kesimpulan adalah kadar dan variasi fenotipe albumin induk kembar cenderung tertinggi adalah Suffas, diikuti dengan Dormas dan teredah pada domba Sapudi. Sebaliknya kadar dan variasi fenotipe albumin induk beranak tunggal cenderung tertinggi adalah Suffas, Sapudi dan terendah adalah Dormas. Ini berarti induk domba Sapudi mempunyai potensi fisiologis lebih baik untuk kelahiran kembar daripada domba Suffas dan Dormas. Pengembangan
induk domba Sapudi kelahiran kembar harus menjadi salah satu kriteria prioritas seleksi.

Kata kunci: Domba, albumin, sapudi, dormas, suffas

PHENOTYPE PROFILE OF ONE YEAR BODY WEIGHT AT INDONESIAN LOCAL ETTAWAH GOATS IN FRATERNAL TWINS

Mudawamah 1*, Didik Roihuddin2, Nurul Humaidah2, Zulchaidi2, Sumartono2, and Gatot Ciptadi3
1Postgraduate of Animal Husbandry, University of Islam Malang, Indonesia
2Faculty of Animal Husbandry, University of Islam Malang, Indonesia
3Faculty of Animal Husbandry, Brawijaya University Malang, Indonesia
Corresponding email: mudawamah@unisma.ac.id

Abstract

The purpose of this study was to describe the phenotypic profile of body weight at one yearof male and female came from fraternal twins in Indonesian Local Ettawah Goat (ILEG) or PE Goat. This research method was a case study with data retrieval using purposive sampling with the criteria of male and female fraternal twins. The variables observed were the average and variance of body weight in fraternal twin goats at one year. Data analysed descriptive and unpaired t-test with excel program. The results showed that male goats’ body weight at one year of age was significantly (P < 0.01) higher than that of female goats at fraternal twins. At one year of age, the body weight variance in male goats was higher than that of female goats at fraternal twins. The conclusion was that the phenotype profile of male ILEG goats was more varied, seen from the average and diversity of body weight, which was 15.37% and 52.24% higher than females. This research implies that feeding male goats should be based on body weight, not on age, to increase their potential optimally.

Keyword: PE Goat, twin, variance, body weight

Magister Peternakan Unisma Malang Optimalkan Hasil Produksi Melalui Kajian Gen Tyr pada Unggas

Di tengah pandemi Dosen dan Mahasiswa Program Magister Peternakan Unisma Malang terus berinovasi. Kali ini, inovasinya tercetus melalui penelitian dalam bentuk research group Animal Molecular Genetics, oleh tim yang di ketuai  Dr. Ir. Mudawamah, M.Si  dan beranggotakan Afidatul Masruroh dan Fitriyah.

Dr. Ir. Mudawamah, M.Si , Dosen Magister Pertanian Unisma sekaligus ketua research group menuturkan bahwa kegiatan ini ialah salah satu payung penelitian kajian gen Tyrosinase (TYR) pada unggas sebagai dasar pijakan manajemen pemeliharaan, khususnya pakan. “Selama ini pemberian pakan pada unggas selalu disamakan dan berpengaruh pada hasil produksi,” ujarnya.

Terhalang situasi lockdown, membuat mahasiswa tidak bisa melakukan penelitian jarak jauh. Timbul ide melakukan penelitian tanpa perlu akses keluar kota dan disepakati untuk melakukan penelitian di tempat tinggal masing-masing.

Lebih lanjut, Dr. Ir. Mudawamah, M.Si menuturkan untuk penelitian ini disepakati, Afidaful Masruroh meneliti ternak Ayam Ras Petelur Novogen milik keluarganya di karangploso, Kabupaten Malang. Sedangkan Fitriyah meneliti ternak ras Puyuh Cortunix cortunix japonica di peternakan tempatnya bekerja di SMKN 1 Grati, Pasuruan.

Melalui penelitian ini dapat ditarik kesimpulan bahwa harus ada manajemen pakan yang berbeda pada ayam ras dan puyuh karena memiliki gen TYR yang berbeda. “Melalui penelitian ini, Gen TYR dapat dibedakan berdasarkan warna bulu. Unggas dengan warna bulu cerah mempunyai gen TYR cenderung rendah. Jadi harus mendapatkan perlakuan khusus dengan memberikan pakan sumber melamin sehingga hasil produksi bisa lebih optimal,” terang Mudawamah, Dosen Magister Pertanian Unisma Malang. Perlu diketahui, hasil penelitian ini telah dipublikasikan dijurnal nasional shinta 3. (*)

sumber

Dosen Peternakan Gandeng Mahasiswa S2 Untuk Kembangkan Pejantan Kambing PE Unggul

Kambing PE merupakan salah satu ternak lokal Indonesia yg sudah diakui secara nasional. Untuk itu perlu optimalisasi potensi kambing PE melalui potensi keunggulan pejantannya. Pejantan berkontribusi lebih besar dlm distribusi genetik dibandingkan dengan betina, dengan kawin alam satu ekor pejantan mampu mengawini 10 ekor betina. Untuk itu perlu dilakukan evaluasi genetik pejantan kambing PE sehingga manpu membantu mempercepat peningkatan kualitas genetik pejantan.

Ibu Mudawamah (Dosen Fapet Unisma) dan P. Zulchaidi (alumni S1 dan S2 Fapet Unisma)

Growth response and vital statistics of fat and thin tailed sheep with soybean husk supplements in Malang District

M Nasich1, G Ciptadi1, A Budiarto1, SB Siswijono1, Hermanto1, A Ridhowi1, Mudawamah2, DKH Widjaja1, ARI Putri1 , HN Karima3, S Septian1 and AM Ramadhan 1

1 Faculty of Animal Husbandery, Brawijaya University, Malang, East Java, Indonesia

2 Faculty of Animal Husbandery, University of Islam Malang, East Java, Indonesia

3 Central Laboratory of Life Science, Brawijaya University, Malang, East Java, Indonesia

E-mail:nasich@ub.ac.id

Abstract. This study aimed to determine the pattern of body weight gain and vital statistical measures of fat sheep and thin tails and to determine the response of local sheep production to the provision of soybean meal/skin. The method used in this research is a case study and experimental. The sampling technique is done by a simple random method on vital statistical measures performed by measuring the chest (using a measuring tape) and body length (usingmeasuring stick). The tabulated data were first analyzed for homogeneity and normality, which were then tested by an independent sample t-test using SPSS. As for the growth response, the material used was 16 male FTS and TTS aged under one year. Daily body weight growth between Fat tail Sheep (FTS) and Thin Tail Sheep (TTS) showed very significant differences (P <0.01). Statistical analysis showed that body length between FTS and TTS had no difference (P> 0.05), chest circumference between FTS, and TTS; there was no difference (P>0.05). Adding bodyweight FTS and TTS were respectively 93.29 ± 26.73 g / head / day and 78.18 ± 27.01 g / head / day. The FTS and TTS bodies’ length was 49.81 ± 4.06 cm and 49.34 ± 4.80 cm, respectively, while the chest circumference between FTS and TTS was 63.61 ± 3.98 cm and 62, respectively. 17 ± 4.10 cm. The daily body weight gain of rams fed with additional soybean husk feed statistically results obtained significant differences (P <0.05), the results of the study showed that the Daily Weight Gain (DWG) FTS male respectively P0, P1, P2, and P3 groups respectively namely: 105.07 ± 3.58; 118.08 ± 2.65; 140.38 ± 4.40; 155.01 ± 4.01 ghead/day. The results showed that the feed efficiency of male rams in each group P0, P1, P2, and P3 were: 7.84 ± 0.27; 8.25 ± 0.18; 9.27 ± 0.29; and 9.75 ± 0.32%. While for TTS also obtained a significant difference (P <0.05) DWG at P0, P1, P2, P3 is 101.02 ± 2.18; 116.9 ± 2.88; 127.82 ± 3.20; 140.31 ± 2.41 g / head / day, so that the efficiency of feed obtained for TTS is P0, P1, P2, P3 respectively 6 ± 0.19; 7.14 ± 0.11; 8.87 ± 0.22; 9.85 ± 0.12. It was concluded that the provision of soybean meal had a significant positive effect on growth and vital statistics, both for sheep with fat tails and thin tails.

Perbedaan Exercise dan Pemeliharaan terhadap Waktu Tempuh dan Kecepatan Lari Sapi Karapan

Differences of Exercise and Maintenance of Racing Cattle on Mileage and Running Speed

A. K. Rahman, M. Mudawamah* dan S. Susilowati

Fakultas Peternakan Universitas Islam Malang, Jl. MT Haryono 193 Malang

Corresponding e-mail : mudawamah@unisma.ac.id

ABSTRACT

The purpose of this study was to determine mileage and running speed of racing cattle with the differences in exercise and maintenance in Bulangan Branta Village, Pegantenan District, Pamekasan Regency. The method used a case study and purposive sampling with criteria of racing type, Madura cattle, bulls aged 2-3 years. The research consisted of two treatment groups, namely group one (K1) with exercise (frequency) and maintenance (bathing, drying, massage and giving herbs) which were different from group two (K2), with a total of 20 cows. The variables observed were mileage and running speed which were calculated based on the same distance traveled, 222 m. The data analysis used was the independent t-test using Ms. Excel. The results indicated that the average mileage for K1 cattle was 18.4 seconds and that for K2 was 20.8 seconds. Meanwhile, the average running speed of the K1 was 12.03 m / sec and the K2 races were 10.69 m / sec. The conclusion is that the mileage and running speed of racing bull was higher significantly different in K1 (exercise) than K2 (maintanance).

Key words: exercise, maintenance, Madura cattle

ABSTRAK

Tujuan penelitian ini adalah untuk mengetahui perbedaan terhadap waktu tempuh serta kecepatan lari dengan perbedaan exercise dan pemeliharaan pada sapi karapan di desa Bulangan Branta Kecamatan Pegantenan Kabupaten Pamekasan. Metode yang digunakan adalah metode studi kasus dengan pengambilan sampel purposive sampling dengan kriteria sapi Madura jantan tipe karapan dengan umur 2-3 tahun. Materi penelitian terdiri dari dua kelompok perlakuan yaitu kelompok satu (K1) dengan exercise (frekuensi) dan pemeliharaan (memandikan, penjemuran, pemijatan dan pemberian jamu) yang berbeda dengan kelompok dua (K2), dengan total sapi 20 ekor. Variabel yang diamati adalah waktu tempuh dan kecepatan lari yang dihitung berdarkan jarak tempuh yang sama yaitu 222 m. Analisis data yang digunakan ialah independent t test menggunakan Ms. Excel. Hasil penelitian ini menunjukkan bahwa rataan waktu tempuh sapi karapan K1 adalah 18,4 detik dan sapi karapan K2 adalah 20,8 detik. Rataan nilai kecepatan lari sapi karapan K1 ialah 12,03 m/detik dan sapi karapan K2 ialah 10,69 m/detik. Dari hasil penelitian tersebut dapat disimpulkan bahwa rataan nilai waktu tempuh dan kecepatan lari sapi sangat berbeda nyata antara sapi karapan K1 (exercise) terhadap sapi karapan K2 (maintanance).

Kata kunci: exercise, pemeliharaan, sapi Madura

The Prolific Variation, Body Morphometrics, and Breeding Value of Indonesian Local Etawah Goat Based in East Java

Mudawamah 1*, Gatot Ciptadi 2 and Irawati Dinasari Retnaningtyas 1

1 Faculty of Animal Husbandry, University of Islam Malang, Jl. MT Haryono 193 Malang

2 Faculty of Animal Husbandry, Brawijaya University of Malang, Jl. Veteran Malang

*Corresponding email: mudawamah@unisma.ac.id

Abstract. A crucial trait of a high economic value of goats is calving to more than one kid (prolificacy potency). The high prolificacy potency (> 1 kid) has a higher income compared to single kids. This study described the potential of Indonesian Local Etawah Goat (ILEG) for prolific trait and the morphometric of body and breeding values in various environments as a basis for selection. It involved smallholder farmers who breed ILEG does from 14 villages in East Java. The research was conducted on a field survey to obtain primary data about the phenotypic superior ILEG goats based on the status of the prolific trait. The study used 520 does with 1347 prolific records obtained. The results showed that the prolificacy values ranged from 2.12-1.42 heads/calving (medium to high category). The variation of prolificacy was 0.53, and the breeding values of the prolificacy trait were 1.48-1.74. The average of body morphometrics was varied with the following details. Chest circumference was 81.06 + 4.63 cm, body length was 76.64 + 4.33 cm, shoulder height was 75.34 + 5.83 cm and ear length were 27.44 + 3.02 cm. This study concluded that the prolific rate was medium to high category. The prolific variation was higher than body morphometry variation, and the prolificacy EBVs of breeding villages divided into four unique pattern boxplots. The prolific trait could be the basis for new considerations in the ILEG breeding program, either through selection or mating.

Keywords: doe, village breeding center, productivity

Abstrak. Salah satu sifat yang krusial dan bernilai ekonomi tinggi pada kambing adalah kemampuan

melahirkan lebih dari satu anak (potensi prolifik). Potensi prolifik yang tinggi (> 1 anak) memiliki nilai ekonomi yang lebih tinggi dibandingkan dengan anak tunggal. Tujuan penelitian ini adalah untuk mengetahui potensi kambing Peranakan Etawah (PE) pada sifat prolifik dan morfometri tubuh serta nilai pemuliaan (EBV) di berbagai lingkungan sebagai dasar seleksi. Untuk mencapai tujuan tersebut maka penelitian ini melibatkan peternak rakyat yang membudidayakan PE yang berasal dari 14 wilayah pembibitan kambing di peternakan rakyat di Jawa Timur. Penelitian dilakukan dengan survei lapangan untuk mendapatkan data primer tentang fenotipe kambing PE unggul berdasarkan status sifat prolifiknya. Penelitian ini menggunakan 520 induk dengan 1.347 catatan prolifik. Hasil penelitian menunjukkan nilai prolifik berkisar antara 2,12-1,42 anak/kelahiran (kategori sedang sampai tinggi) dengan rerata variasi prolifik 0,53 dan EBV sebesar 1,48-1,74. Rataan morfometri tubuh adalah bervariasi dengan rincian berikut. Rataan lingkar dada sebesar 81,06 + 4,63 cm, panjang tubuh adalah 76,64 + 4,33 cm, tinggi pundak adalah 75,34 + 5,83 cm dan panjang telinga adalah 27,44 + 3,02 cm. Kesimpulan dari penelitian ini adalah rataan prolifik kambing PE termasuk kategori sedang sampai tinggi. Variasi prolifik adalah lebih tinggi dibandingkan dengan morfometri tubuh dengan profil EBV prolifik terbagi empat pola unik boxplot. Sifat prolifik berpotensi menjadi dasar pertimbangan baru dalam program pemuliaan kambing PE baik melalui seleksi maupun perkawinan.

Kata kunci: Induk, village breeding center, productivitas

Comparison of serum protein profile in Indonesian Local Ettawah goats with single and twin offspring using SDS-PAGE

M Mudawamah1,*, GR Putri1, Sumartono2 and G Ciptadi3

1 Post Graduate of Animal Husbandry, University of Islam Malang, Indonesia

2 Faculty of Animal Husbandry, University of Islam Malang, Indonesia

3 Faculty of Animal Husbandry, Brawijaya University, Indonesia

*Corresponding author: mudawamah@unisma.ac.id

Abstract. Indonesian Local Ettawah Goats (ILEG) is local Indonesian livestock with more than one offspring potential. There is no description of the serum protein profile of female goat with single and twin offspring. This study aimed to compare the protein band type, the percentage of protein band appearance, protein band thickness between the female goat serum of single and twin offspring. This research method was a case study at the breeding village of Ampel Gading Malang East Java, Indonesia. The sample came from ILEG female with single and twin offspring, which had a record of three offsprings with six replications per group. Serum samples were isolated from whole blood taken through the goat jugular vein. Separation of blood serum with Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE) and performed by Panther Data Base for analysis of protein type data. The results showed that single and twin ILEG had ten types of protein bands 13-140 kDa with an average percentage of protein band appearances of 8.32% higher in twin offsprings compared to single offspring. The thickening level of a protein band at 44-94 kDa in female goat with twin offsprings was increased expression compared to single offspring. The ILEG protein profile of twin offspring was higher in quality and quantity than single offspring. The research recommends molecular protein weight at 44-94 kDa as a candidate to an early detect female goat with twin offspring.

Keywords: protein band, prolific, local goat

Use of genetic similarity analysis for identification and study of the origin of Indonesian local goats based on X-Y sex chromosome karyotyping and cytochrome-b genes sequence

G Ciptadi1*, A Budiarto1, M Nasich 1, Mudawamah3, S Rahayu 4, Dyah Ayu O. A.P5, A I Putri1, H N Karima5, Y Oktanella4, Y Saynandya4 and R G Almaida4

1 Faculty of Animal Sciences, Brawijaya University, Malang, East Java, Indonesia

2 Faculty of Animal Husbandry, Universitas Negeri Islam Malang, East Java, Indonesia

3 Faculty of Mathematics and Natural Sciences, Brawijaya University, Malang, East

Java, Indonesia

4 Faculty of Vetenary Medicine, Brawijaya University, Malang, East Java, Indonesia

5 Central Laboratory of Life Sciences, Brawijaya University, Malang, East Java, Indonesia

E-mail: ciptadi@ub.ac.id

Abstract. The history and origins of Indonesian local goats are still compiled and described based on information on phenotypic characters, and there is still limited research that studies the origin of goats based on cellular and molecular analysis. The purpose of this study was to identify the origin of local goats in Indonesia based on the emergence of the profile of the sex chromosome band and the results of the Cytochrome b (Cyt-b) gene sequence. The research method is a case study with analysis of sex chromosome band profile results of preparation with G-banding and Cyt-B gene sequences. Genetic similarity analysis was performed using mitochondrial DNA (mtDNA). The sample used was whole blood from six Senduro goats, three male Etawah Grade and three Etawah goats. Chromosome preparation was done by G-Staining and analyzed by cytovision then analyzed its similarity with ancestor breeds. The whole blood sample was isolated with the Blood DNA Preparation Kit by Jena Bioscience. The primers used are Forward (Cytb_F) 5’GCAATTGCCATAGTCCACCT’3 and Reverse (Cytb_R) 5’GGATTTGCC GGGGTATAGTT ‘3. The PCR results were sequenced by the Sanger method. Gene sequence analysis is performed using MEGA-X software. The results showed that the genetic distance between intraspesies and interspesies of Senduro goats and PE goats was 0% or ≤ 2%. Conclusions based on genetic similarity from this study are Senduro goats and Etawah Peranakan goats, and Etawah has a close kinship, instead there is a distant kinship with the comparison of Capra Hircus, but it has a close kinship between individuals.