M Nasich1, G Ciptadi1, A Budiarto1, SB Siswijono1, Hermanto1, A Ridhowi1, Mudawamah2, DKH Widjaja1, ARI Putri1 , HN Karima3, S Septian1 and AM Ramadhan 1

1 Faculty of Animal Husbandery, Brawijaya University, Malang, East Java, Indonesia

2 Faculty of Animal Husbandery, University of Islam Malang, East Java, Indonesia

3 Central Laboratory of Life Science, Brawijaya University, Malang, East Java, Indonesia

E-mail:nasich@ub.ac.id

Abstract. This study aimed to determine the pattern of body weight gain and vital statistical measures of fat sheep and thin tails and to determine the response of local sheep production to the provision of soybean meal/skin. The method used in this research is a case study and experimental. The sampling technique is done by a simple random method on vital statistical measures performed by measuring the chest (using a measuring tape) and body length (usingmeasuring stick). The tabulated data were first analyzed for homogeneity and normality, which were then tested by an independent sample t-test using SPSS. As for the growth response, the material used was 16 male FTS and TTS aged under one year. Daily body weight growth between Fat tail Sheep (FTS) and Thin Tail Sheep (TTS) showed very significant differences (P <0.01). Statistical analysis showed that body length between FTS and TTS had no difference (P> 0.05), chest circumference between FTS, and TTS; there was no difference (P>0.05). Adding bodyweight FTS and TTS were respectively 93.29 ± 26.73 g / head / day and 78.18 ± 27.01 g / head / day. The FTS and TTS bodies’ length was 49.81 ± 4.06 cm and 49.34 ± 4.80 cm, respectively, while the chest circumference between FTS and TTS was 63.61 ± 3.98 cm and 62, respectively. 17 ± 4.10 cm. The daily body weight gain of rams fed with additional soybean husk feed statistically results obtained significant differences (P <0.05), the results of the study showed that the Daily Weight Gain (DWG) FTS male respectively P0, P1, P2, and P3 groups respectively namely: 105.07 ± 3.58; 118.08 ± 2.65; 140.38 ± 4.40; 155.01 ± 4.01 ghead/day. The results showed that the feed efficiency of male rams in each group P0, P1, P2, and P3 were: 7.84 ± 0.27; 8.25 ± 0.18; 9.27 ± 0.29; and 9.75 ± 0.32%. While for TTS also obtained a significant difference (P <0.05) DWG at P0, P1, P2, P3 is 101.02 ± 2.18; 116.9 ± 2.88; 127.82 ± 3.20; 140.31 ± 2.41 g / head / day, so that the efficiency of feed obtained for TTS is P0, P1, P2, P3 respectively 6 ± 0.19; 7.14 ± 0.11; 8.87 ± 0.22; 9.85 ± 0.12. It was concluded that the provision of soybean meal had a significant positive effect on growth and vital statistics, both for sheep with fat tails and thin tails.

Differences of Exercise and Maintenance of Racing Cattle on Mileage and Running Speed

A. K. Rahman, M. Mudawamah* dan S. Susilowati

Fakultas Peternakan Universitas Islam Malang, Jl. MT Haryono 193 Malang

Corresponding e-mail : mudawamah@unisma.ac.id

ABSTRACT

The purpose of this study was to determine mileage and running speed of racing cattle with the differences in exercise and maintenance in Bulangan Branta Village, Pegantenan District, Pamekasan Regency. The method used a case study and purposive sampling with criteria of racing type, Madura cattle, bulls aged 2-3 years. The research consisted of two treatment groups, namely group one (K1) with exercise (frequency) and maintenance (bathing, drying, massage and giving herbs) which were different from group two (K2), with a total of 20 cows. The variables observed were mileage and running speed which were calculated based on the same distance traveled, 222 m. The data analysis used was the independent t-test using Ms. Excel. The results indicated that the average mileage for K1 cattle was 18.4 seconds and that for K2 was 20.8 seconds. Meanwhile, the average running speed of the K1 was 12.03 m / sec and the K2 races were 10.69 m / sec. The conclusion is that the mileage and running speed of racing bull was higher significantly different in K1 (exercise) than K2 (maintanance).

Key words: exercise, maintenance, Madura cattle

ABSTRAK

Tujuan penelitian ini adalah untuk mengetahui perbedaan terhadap waktu tempuh serta kecepatan lari dengan perbedaan exercise dan pemeliharaan pada sapi karapan di desa Bulangan Branta Kecamatan Pegantenan Kabupaten Pamekasan. Metode yang digunakan adalah metode studi kasus dengan pengambilan sampel purposive sampling dengan kriteria sapi Madura jantan tipe karapan dengan umur 2-3 tahun. Materi penelitian terdiri dari dua kelompok perlakuan yaitu kelompok satu (K1) dengan exercise (frekuensi) dan pemeliharaan (memandikan, penjemuran, pemijatan dan pemberian jamu) yang berbeda dengan kelompok dua (K2), dengan total sapi 20 ekor. Variabel yang diamati adalah waktu tempuh dan kecepatan lari yang dihitung berdarkan jarak tempuh yang sama yaitu 222 m. Analisis data yang digunakan ialah independent t test menggunakan Ms. Excel. Hasil penelitian ini menunjukkan bahwa rataan waktu tempuh sapi karapan K1 adalah 18,4 detik dan sapi karapan K2 adalah 20,8 detik. Rataan nilai kecepatan lari sapi karapan K1 ialah 12,03 m/detik dan sapi karapan K2 ialah 10,69 m/detik. Dari hasil penelitian tersebut dapat disimpulkan bahwa rataan nilai waktu tempuh dan kecepatan lari sapi sangat berbeda nyata antara sapi karapan K1 (exercise) terhadap sapi karapan K2 (maintanance).

Kata kunci: exercise, pemeliharaan, sapi Madura

Mudawamah 1*, Gatot Ciptadi 2 and Irawati Dinasari Retnaningtyas 1

1 Faculty of Animal Husbandry, University of Islam Malang, Jl. MT Haryono 193 Malang

2 Faculty of Animal Husbandry, Brawijaya University of Malang, Jl. Veteran Malang

*Corresponding email: mudawamah@unisma.ac.id

Abstract. A crucial trait of a high economic value of goats is calving to more than one kid (prolificacy potency). The high prolificacy potency (> 1 kid) has a higher income compared to single kids. This study described the potential of Indonesian Local Etawah Goat (ILEG) for prolific trait and the morphometric of body and breeding values in various environments as a basis for selection. It involved smallholder farmers who breed ILEG does from 14 villages in East Java. The research was conducted on a field survey to obtain primary data about the phenotypic superior ILEG goats based on the status of the prolific trait. The study used 520 does with 1347 prolific records obtained. The results showed that the prolificacy values ranged from 2.12-1.42 heads/calving (medium to high category). The variation of prolificacy was 0.53, and the breeding values of the prolificacy trait were 1.48-1.74. The average of body morphometrics was varied with the following details. Chest circumference was 81.06 + 4.63 cm, body length was 76.64 + 4.33 cm, shoulder height was 75.34 + 5.83 cm and ear length were 27.44 + 3.02 cm. This study concluded that the prolific rate was medium to high category. The prolific variation was higher than body morphometry variation, and the prolificacy EBVs of breeding villages divided into four unique pattern boxplots. The prolific trait could be the basis for new considerations in the ILEG breeding program, either through selection or mating.

Keywords: doe, village breeding center, productivity

Abstrak. Salah satu sifat yang krusial dan bernilai ekonomi tinggi pada kambing adalah kemampuan

melahirkan lebih dari satu anak (potensi prolifik). Potensi prolifik yang tinggi (> 1 anak) memiliki nilai ekonomi yang lebih tinggi dibandingkan dengan anak tunggal. Tujuan penelitian ini adalah untuk mengetahui potensi kambing Peranakan Etawah (PE) pada sifat prolifik dan morfometri tubuh serta nilai pemuliaan (EBV) di berbagai lingkungan sebagai dasar seleksi. Untuk mencapai tujuan tersebut maka penelitian ini melibatkan peternak rakyat yang membudidayakan PE yang berasal dari 14 wilayah pembibitan kambing di peternakan rakyat di Jawa Timur. Penelitian dilakukan dengan survei lapangan untuk mendapatkan data primer tentang fenotipe kambing PE unggul berdasarkan status sifat prolifiknya. Penelitian ini menggunakan 520 induk dengan 1.347 catatan prolifik. Hasil penelitian menunjukkan nilai prolifik berkisar antara 2,12-1,42 anak/kelahiran (kategori sedang sampai tinggi) dengan rerata variasi prolifik 0,53 dan EBV sebesar 1,48-1,74. Rataan morfometri tubuh adalah bervariasi dengan rincian berikut. Rataan lingkar dada sebesar 81,06 + 4,63 cm, panjang tubuh adalah 76,64 + 4,33 cm, tinggi pundak adalah 75,34 + 5,83 cm dan panjang telinga adalah 27,44 + 3,02 cm. Kesimpulan dari penelitian ini adalah rataan prolifik kambing PE termasuk kategori sedang sampai tinggi. Variasi prolifik adalah lebih tinggi dibandingkan dengan morfometri tubuh dengan profil EBV prolifik terbagi empat pola unik boxplot. Sifat prolifik berpotensi menjadi dasar pertimbangan baru dalam program pemuliaan kambing PE baik melalui seleksi maupun perkawinan.

Kata kunci: Induk, village breeding center, productivitas

M Mudawamah1,*, GR Putri1, Sumartono2 and G Ciptadi3

1 Post Graduate of Animal Husbandry, University of Islam Malang, Indonesia

2 Faculty of Animal Husbandry, University of Islam Malang, Indonesia

3 Faculty of Animal Husbandry, Brawijaya University, Indonesia

*Corresponding author: mudawamah@unisma.ac.id

Abstract. Indonesian Local Ettawah Goats (ILEG) is local Indonesian livestock with more than one offspring potential. There is no description of the serum protein profile of female goat with single and twin offspring. This study aimed to compare the protein band type, the percentage of protein band appearance, protein band thickness between the female goat serum of single and twin offspring. This research method was a case study at the breeding village of Ampel Gading Malang East Java, Indonesia. The sample came from ILEG female with single and twin offspring, which had a record of three offsprings with six replications per group. Serum samples were isolated from whole blood taken through the goat jugular vein. Separation of blood serum with Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE) and performed by Panther Data Base for analysis of protein type data. The results showed that single and twin ILEG had ten types of protein bands 13-140 kDa with an average percentage of protein band appearances of 8.32% higher in twin offsprings compared to single offspring. The thickening level of a protein band at 44-94 kDa in female goat with twin offsprings was increased expression compared to single offspring. The ILEG protein profile of twin offspring was higher in quality and quantity than single offspring. The research recommends molecular protein weight at 44-94 kDa as a candidate to an early detect female goat with twin offspring.

Keywords: protein band, prolific, local goat

G Ciptadi1*, A Budiarto1, M Nasich 1, Mudawamah3, S Rahayu 4, Dyah Ayu O. A.P5, A I Putri1, H N Karima5, Y Oktanella4, Y Saynandya4 and R G Almaida4

1 Faculty of Animal Sciences, Brawijaya University, Malang, East Java, Indonesia

2 Faculty of Animal Husbandry, Universitas Negeri Islam Malang, East Java, Indonesia

3 Faculty of Mathematics and Natural Sciences, Brawijaya University, Malang, East

Java, Indonesia

4 Faculty of Vetenary Medicine, Brawijaya University, Malang, East Java, Indonesia

5 Central Laboratory of Life Sciences, Brawijaya University, Malang, East Java, Indonesia

E-mail: ciptadi@ub.ac.id

Abstract. The history and origins of Indonesian local goats are still compiled and described based on information on phenotypic characters, and there is still limited research that studies the origin of goats based on cellular and molecular analysis. The purpose of this study was to identify the origin of local goats in Indonesia based on the emergence of the profile of the sex chromosome band and the results of the Cytochrome b (Cyt-b) gene sequence. The research method is a case study with analysis of sex chromosome band profile results of preparation with G-banding and Cyt-B gene sequences. Genetic similarity analysis was performed using mitochondrial DNA (mtDNA). The sample used was whole blood from six Senduro goats, three male Etawah Grade and three Etawah goats. Chromosome preparation was done by G-Staining and analyzed by cytovision then analyzed its similarity with ancestor breeds. The whole blood sample was isolated with the Blood DNA Preparation Kit by Jena Bioscience. The primers used are Forward (Cytb_F) 5’GCAATTGCCATAGTCCACCT’3 and Reverse (Cytb_R) 5’GGATTTGCC GGGGTATAGTT ‘3. The PCR results were sequenced by the Sanger method. Gene sequence analysis is performed using MEGA-X software. The results showed that the genetic distance between intraspesies and interspesies of Senduro goats and PE goats was 0% or ≤ 2%. Conclusions based on genetic similarity from this study are Senduro goats and Etawah Peranakan goats, and Etawah has a close kinship, instead there is a distant kinship with the comparison of Capra Hircus, but it has a close kinship between individuals.